www

Unnamed repository; edit this file 'description' to name the repository.
Log | Files | Refs | README

commit 2066dbc5770c08bec0fca7ff21cbfeb8916238da
parent f5a043b7e664ea86479e5a1ebaf10922eeaeed95
Author: Stephen Chang <stchang@ccs.neu.edu>
Date:   Mon,  7 Mar 2016 23:53:20 -0500

mlish: add require/provide, boxes, set!, more iterators

- add tests: fibo, hash, k-nucleotide

Diffstat:
Mtapl/mlish.rkt | 114++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++-----
Mtapl/tests/mlish/fasta.mlish | 18+++++++++++++++---
Atapl/tests/mlish/fibo.mlish | 17+++++++++++++++++
Atapl/tests/mlish/hash.mlish | 14++++++++++++++
Atapl/tests/mlish/knuc.mlish | 65+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
Mtapl/tests/run-all-mlish-tests.rkt | 4++++
6 files changed, 223 insertions(+), 9 deletions(-)

diff --git a/tapl/mlish.rkt b/tapl/mlish.rkt @@ -16,6 +16,7 @@ (provide (rename-out [ext-stlc:and and] [ext-stlc:#%datum #%datum])) (reuse [cons stlc:cons] nil isnil head tail [list stlc:list] List ~List List? #:from "stlc+cons.rkt") (provide (rename-out [stlc:list list] [stlc:cons cons])) +(reuse ref deref := Ref #:from "stlc+box.rkt") ;; ML-like language ;; - top level recursive functions @@ -428,9 +429,16 @@ : τ_out)]) (define-typed-syntax when [(_ test body ...) - #:with test- (⇑ test as Bool) +; #:with test- (⇑ test as Bool) + #:with [test- _] (infer+erase #'test) #:with [(body- _) ...] (infers+erase #'(body ...)) (⊢ (when test- body- ...) : Unit)]) +(define-typed-syntax unless + [(_ test body ...) +; #:with test- (⇑ test as Bool) + #:with [test- _] (infer+erase #'test) + #:with [(body- _) ...] (infers+erase #'(body ...)) + (⊢ (unless test- body- ...) : Unit)]) ;; sync channels and threads (define-type-constructor Channel) @@ -463,6 +471,13 @@ (define-primop random : (→ Int Int)) (define-primop integer->char : (→ Int Char)) (define-primop string->number : (→ String Int)) +;(define-primop number->string : (→ Int String)) +(define-typed-syntax num->str #:export-as number->string + [(_ n) + #'(num->str n (ext-stlc:#%datum . 10))] + [(_ n rad) + #:with args- (⇑s (n rad) as Int) + (⊢ (number->string . args-) : String)]) (define-primop string : (→ Char String)) (define-primop sleep : (→ Int Unit)) (define-primop string=? : (→ String String Bool)) @@ -533,11 +548,22 @@ #:with [e- (ty)] (⇑ e as Vector) (⊢ (in-vector e-) : (Sequence ty))]) +(define-typed-syntax in-list + [(_ e) + #:with [e- (ty)] (⇑ e as List) + (⊢ (in-list e-) : (Sequence ty))]) + +(define-typed-syntax in-lines + [(_ e) + #:with e- (⇑ e as String) + (⊢ (in-lines (open-input-string e-)) : (Sequence String))]) + (define-typed-syntax for - [(_ ([x:id e]...) body) + [(_ ([x:id e]...) b ... body) #:with ([e- (ty)] ...) (⇑s (e ...) as Sequence) - #:with [(x- ...) body- ty_body] (infer/ctx+erase #'([x : ty] ...) #'body) - (⊢ (for ([x- e-] ...) body-) : Unit)]) + #:with [(x- ...) (b- ... body-) (ty_b ... ty_body)] + (infers/ctx+erase #'([x : ty] ...) #'(b ... body)) + (⊢ (for ([x- e-] ...) b- ... body-) : Unit)]) (define-typed-syntax for* [(_ ([x:id e]...) body) #:with ([e- (ty)] ...) (⇑s (e ...) as Sequence) @@ -563,6 +589,24 @@ #:when (typecheck? #'ty_body #'ty_init) (⊢ (for/fold ([acc- init-]) ([x- e-] ...) body-) : ty_body)]) +(define-typed-syntax for/hash + [(_ ([x:id e]...) body) + #:with ([e- (ty)] ...) (⇑s (e ...) as Sequence) + #:with [(x- ...) body- (~× ty_k ty_v)] + (infer/ctx+erase #'([x : ty] ...) #'body) + (⊢ (for/hash ([x- e-] ...) (let ([t body-]) (values (car t) (cadr t)))) + : (Hash ty_k ty_v))]) + +(define-typed-syntax for/sum + [(_ ([x:id e]... + (~optional (~seq #:when guard) #:defaults ([guard #'#t]))) + body) + #:with ([e- (ty)] ...) (⇑s (e ...) as Sequence) + #:with [(x- ...) (guard- body-) (_ ty_body)] + (infers/ctx+erase #'([x : ty] ...) #'(guard body)) + #:when (Int? #'ty_body) + (⊢ (for/sum ([x- e-] ... #:when guard-) body-) : Int)]) + ; printing and displaying (define-typed-syntax printf [(_ str e ...) @@ -615,7 +659,11 @@ ; (⊢ (hash->list e-) : (Sequence (× ty_k ty_v)))]) +; mutable hashes (define-typed-syntax hash + [(_ (~and tys {ty_key ty_val})) + #:when (brace? #'tys) + (⊢ (make-hash) : (Hash ty_key ty_val))] [(_ (~seq k v) ...) #:with ([k- ty_k] ...) (infers+erase #'(k ...)) #:with ([v- ty_v] ...) (infers+erase #'(v ...)) @@ -623,11 +671,35 @@ #:when (same-types? #'(ty_v ...)) #:with ty_key (stx-car #'(ty_k ...)) #:with ty_val (stx-car #'(ty_v ...)) - (⊢ (make-immutable-hash (list (cons k- v-) ...)) : (Hash ty_key ty_val))]) - + (⊢ (make-hash (list (cons k- v-) ...)) : (Hash ty_key ty_val))]) +(define-typed-syntax hash-set! + [(_ h k v) + #:with [h- (ty_key ty_val)] (⇑ h as Hash) + #:with [k- ty_k] (infer+erase #'k) + #:with [v- ty_v] (infer+erase #'v) + #:when (typecheck? #'ty_k #'ty_key) + #:when (typecheck? #'ty_v #'ty_val) + (⊢ (hash-set! h- k- v-) : Unit)]) +(define-typed-syntax hash-ref/tc #:export-as hash-ref + [(_ h k) #'(hash-ref/tc h k (ext-stlc:#%datum . #f))] + [(_ h k fail) + #:with [h- (ty_key ty_val)] (⇑ h as Hash) + #:with [k- ty_k] (infer+erase #'k) + #:when (typecheck? #'ty_k #'ty_key) + #:with (fail- _) (infer+erase #'fail) ; default val can be any + (⊢ (hash-ref h- k- fail-) : ty_val)]) +(define-typed-syntax hash-has-key? + [(_ h k) + #:with [h- (ty_key _)] (⇑ h as Hash) + #:with [k- ty_k] (infer+erase #'k) + #:when (typecheck? #'ty_k #'ty_key) + (⊢ (hash-has-key? h- k-) : Bool)]) + (define-base-type String-Port) (define-primop open-output-string : (→ String-Port)) (define-primop get-output-string : (→ String-Port String)) +(define-primop string-upcase : (→ String String)) + (define-typed-syntax write-string/tc #:export-as write-string [(_ str out) #'(write-string/tc str out (ext-stlc:#%datum . 0) (string-length/tc str))] @@ -659,8 +731,10 @@ (define-primop fl+ : (→ Float Float Float)) (define-primop fl* : (→ Float Float Float)) +(define-primop fl/ : (→ Float Float Float)) (define-primop flceiling : (→ Float Float)) (define-primop inexact->exact : (→ Float Int)) +(define-primop exact->inexact : (→ Int Float)) (define-primop char->integer : (→ Char Int)) (define-primop fx->fl : (→ Int Float)) (define-typed-syntax quotient+remainder @@ -669,3 +743,31 @@ #:with y- (⇑ y as Int) (⊢ (call-with-values (λ () (quotient/remainder x- y-)) list) : (× Int Int))]) +(define-primop quotient : (→ Int Int Int)) + +(define-typed-syntax set! + [(_ x:id e) + #:with [x- ty_x] (infer+erase #'x) + #:with [e- ty_e] (infer+erase #'e) + #:when (typecheck? #'ty_e #'ty_x) + (⊢ (set! x e-) : Unit)]) + +(define-typed-syntax provide + [(_ x:id) + #:with [x- ty_x] (infer+erase #'x) + #:with x-ty (format-id #'x "~a-ty" #'x) ; TODO: use hash-code to generate this tmp + #'(begin + (provide x) + (define-type-alias x-ty ty_x) + (provide x-ty))]) +(define-typed-syntax require-typed + [(_ x:id #:from mod) + #:with x-ty (format-id #'x "~a-ty" #'x) + #:with y (generate-temporary #'x) + #'(begin + (require (rename-in (only-in mod x x-ty) [x y])) + (define-syntax x (make-rename-transformer (assign-type #'y #'x-ty))))]) + +(define-base-type Regexp) +(define-primop regexp-match : (→ Regexp String (List String))) +(define-primop regexp : (→ String Regexp)) diff --git a/tapl/tests/mlish/fasta.mlish b/tapl/tests/mlish/fasta.mlish @@ -143,10 +143,22 @@ [R str -> (random-fasta ">THREE Homo sapiens frequency\n" (* n 5) HOMOSAPIEN R)])) (check-type (proj res1 1) : String - -> ">TWO IUB ambiguity codes\ntaaaWKatgWRattaNBttctNagggcgWt\n") + -> ">TWO IUB ambiguity codes\nattRtBtaDtatVataKatgaatcccgDtY\n") +;taaaWKatgWRattaNBttctNagggcgWt\n") ;; should be cttBtatcatatgctaKggNcataaaSatg ? -(proj res1 0) (check-type (proj res2 1) : String -> (string-append ">THREE Homo sapiens frequency\n" - "agggctccaaatcataaagaggaatatattattacacgattagaaaccca\n")) + "atttgcggaaacgacaaatattaacacatcatcagagtaccataaaggga\n" + #;"agggctccaaatcataaagaggaatatattattacacgattagaaaccca\n")) ;; should be taaatcttgtgcttcgttagaagtctcgactacgtgtagcctagtgtttg ? +(define (mk-fasta [n : Int] -> String) + (let + ([res1 (repeat-fasta ">ONE Homo sapiens alu\n" (* n 2) +alu+)] + [res2 (random-fasta ">TWO IUB ambiguity codes\n" (* n 3) IUB 42)] + [res3 + (match res2 with + [R str -> + (random-fasta ">THREE Homo sapiens frequency\n" (* n 5) HOMOSAPIEN R)])]) + (string-append res1 (proj res2 1) (proj res3 1)))) +(provide mk-fasta) +(check-type (mk-fasta 100) : String) diff --git a/tapl/tests/mlish/fibo.mlish b/tapl/tests/mlish/fibo.mlish @@ -0,0 +1,17 @@ +#lang s-exp "../../mlish.rkt" +(require "../rackunit-typechecking.rkt") + +(define (fib [n : Int] -> Int) + (cond [(< n 2) 1] + (else (+ (fib (- n 2)) (fib (sub1 n)))))) + +(define (main [args : (Vector String)] -> Int) + (let ([n (if (= (vector-length args) 0) + 1 + (string->number (vector-ref args 0)))]) + (fib n))) + +(check-type (main (vector "0")) : Int -> 1) +(check-type (main (vector "1")) : Int -> 1) +(check-type (main (vector "2")) : Int -> 2) +(check-type (main (vector "22")) : Int -> 28657) diff --git a/tapl/tests/mlish/hash.mlish b/tapl/tests/mlish/hash.mlish @@ -0,0 +1,14 @@ +#lang s-exp "../../mlish.rkt" +(require "../rackunit-typechecking.rkt") + +(define (main [argv : (Vector String)] -> Int) + (let* ([n (string->number (vector-ref argv 0))] + [hash + (for/hash ([i (in-range n)]) + (let ([j (add1 i)]) + (tup (number->string j 16) j)))]) + (for/sum ([i (in-range 1 (add1 n))] + #:when (hash-ref hash (number->string i))) + 1))) + +(check-type (main (vector "200000")) : Int -> 30999) diff --git a/tapl/tests/mlish/knuc.mlish b/tapl/tests/mlish/knuc.mlish @@ -0,0 +1,65 @@ +#lang s-exp "../../mlish.rkt" +(require "../rackunit-typechecking.rkt") + +(require-typed mk-fasta #:from "fasta.mlish") + +(define (all-counts [len : Int][dna : String] -> (Hash String (Ref Int))) + (let ([table (hash {String (Ref Int)})]) + (for ([s (in-range (- (string-length dna) len) -1 -1)]) + (let ([key (make-string len)]) + (string-copy! key 0 dna s (+ s len)) + (let* ([b (if (hash-has-key? table key) + (hash-ref table key) + (let ([b (ref 0)]) + (hash-set! table key b) + b))]) + (:= b (add1 (deref b)))))) + table)) + +;; (define (write-freqs table) +;; (let* ([content (hash-map table (lambda (k v) (cons k (unbox v))))] +;; [total (exact->inexact (apply + (map cdr content)))]) +;; (for ([a (sort content > #:key cdr)]) +;; (printf "~a ~a\n" +;; (car a) +;; (real->decimal-string (* 100 (/ (cdr a) total)) 3))))) + +#;(define (write-one-freq [table : (Hash String (Ref Int))][key : String] -> Unit) + (let ([cnt (hash-ref table key (box 0))]) + (printf "~a\t~a\n" (unbox cnt) key))) + +(define dna + (let* ([in (mk-fasta 100000)] + ;; Skip to ">THREE ..." + [rst (head (tail (regexp-match (regexp ">THREE Homo sapiens frequency\n(.*)$") in)))]) + (let ([s (open-output-string)]) + ;; Copy everything but newlines to s: + (for ([l (in-lines rst)]) + (write-string l s)) + ;; Extract the string from s: + (string-upcase (get-output-string s))))) + +(check-type dna : String) + +(check-type (all-counts 1 dna) : (Hash String (Ref Int))) +;; ;; 1-nucleotide counts: +;; (write-freqs (all-counts 1 dna)) +;; (newline) + +(check-type (all-counts 2 dna) : (Hash String (Ref Int))) +;; ;; 2-nucleotide counts: +;; (write-freqs (all-counts 2 dna)) +;; (newline) + +;; Specific sequences: +(check-type + (for/list ([seq (in-list (list "GGT" "GGTA" "GGTATT" + "GGTATTTTAATT" "GGTATTTTAATTTATAGT"))]) + (let ([table (all-counts (string-length seq) dna)]) + (if (hash-has-key? table seq) + (deref (hash-ref table seq)) + 0))) + : (List Int) + -> (list 5861 1776 176 0 0)) + #;(write-one-freq (all-counts (string-length seq) dna) + seq) diff --git a/tapl/tests/run-all-mlish-tests.rkt b/tapl/tests/run-all-mlish-tests.rkt @@ -7,3 +7,7 @@ (require "mlish/ary.mlish") (require "mlish/fannkuch.mlish") (require "mlish/fasta.mlish") +(require "mlish/fibo.mlish") +(require "mlish/hash.mlish") +;(require "mlish/heapsort.mlish") +(require "mlish/knuc.mlish")